Novel Anthraquinone-Based Benzenesulfonamide Derivatives and Their Analogues as Potent Human Carbonic Anhydrase Inhibitors with Antitumor Activity: Synthesis, Biological Evaluation, and In Silico Analysis.

In this study, we designed two series of novel anthraquinone-based benzenesulfonamide derivatives and their analogues as potential carbonic anhydrase inhibitors (CAIs) and evaluated their inhibitory activities against off-target human carbonic anhydrase II (hCA II) isoform and tumor-associated human carbonic anhydrase IX (hCA IX) isoform. Most of these compounds exhibited good inhibitory activities against hCA II and IX. The compounds that exhibited the best hCA inhibition were further studied against the MDA-MB-231, MCF-7, and HepG2 cell lines under hypoxic and normoxic conditions. Additionally, the compounds exhibiting the best antitumor activity were subjected to apoptosis and mitochondrial membrane potential assays, which revealed a significant increase in the percentage of apoptotic cells and a notable decrease in cell viability. Molecular docking studies were performed to demonstrate the presence of numerous hydrogen bonds and hydrophobic interactions between the compounds and the active site of hCA. Absorption, distribution, metabolism, excretion (ADME) predictions showed that all of the compounds had good pharmacokinetic and physicochemical properties.

Assessing the role of residue Phe108 of cytochrome P450 3A4 in allosteric effects of midazolam metabolism.

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of more drugs in clinical use than any other xenobiotic-metabolizing enzyme. CYP3A4-mediated drug metabolism is usually allosterically modulated by substrate concentration (homotropic allostery) and other drugs (heterotropic allostery), exhibiting unusual kinetic profiles and regiospecific metabolism. Recent studies suggest that residue Phe108 (F108) of CYP3A4 may have an important role in drug metabolism. In this work, residue mutations were coupled with well-tempered metadynamics simulations to assess the importance of F108 in the allosteric effects of midazolam metabolism. Comparing the simulation results of the wild-type and mutation systems, we identify that the π-π interaction and steric effect between the F108 side chain and midazolam is favorable for the stable binding of substrate in the active site. F108 also plays an important role in the transition of substrate binding mode, which mainly induces the transition of substrate binding mode by forming π-π interactions with multiple aromatic rings of the substrate. Moreover, the side chain of F108 is closely related to the radius and depth of the 2a and 2f channels, and F108 may further regulate drug metabolism by affecting the pathway, orientation, or time of substrate entry into the CYP3A4 active site or product egress from the active site. Altogether, we suggest that F108 affects drug metabolism and regulatory mechanisms by affecting substrate binding stability, binding mode transition, and channel characteristics of CYP3A4. Our findings could promote the understanding of complicated allosteric mechanisms in CYP3A4-mediated drug metabolism, and the knowledge could be used for drug development and disease treatment.

The Potential of Cyclodextrins as Inhibitors for the BM2 Protein: An In Silico Investigation.

The influenza BM2 transmembrane domain (BM2TM), an acid-activated proton channel, is an attractive antiviral target due to its essential roles during influenza virus replication, whereas no effective inhibitors have been reported for BM2. In this study, we draw inspiration from the properties of cyclodextrins (CDs) and hypothesize that CDs of appropriate sizes may possess the potential to act as inhibitors of the BM2TM proton channel. To explore this possibility, molecular dynamics simulations were employed to assess their inhibitory capabilities. Our findings reveal that CD4, CD5, and CD6 are capable of binding to the BM2TM proton channel, resulting in disrupted water networks and reduced hydrogen bond occupancy between H19 and the solvent within the BM2TM channel necessary for proton conduction. Notably, CD4 completely obstructs the BM2TM water channel. Based on these observations, we propose that CD4, CD5, and CD6 individually contribute to diminishing the proton transfer efficiency of the BM2 protein, and CD4 demonstrates promising potential as an inhibitor for the BM2 proton channel.

Differences of Atomic-Level Interactions between Midazolam and Two CYP Isoforms 3A4 and 3A5.

CYP 3A4 and CYP 3A5 are two important members of the human cytochrome P450 family. Although their overall structures are similar, the local structures of the active site are different, which directly leads to obvious individual differences in drug metabolic efficacy and toxicity. In this work, midazolam (MDZ) was selected as the probe substrate, and its interaction with two proteins, CYP 3A4 and CYP 3A5, was studied by molecular dynamics simulation (MD) along with the calculation of the binding free energy. The results show that two protein-substrate complexes have some similarities in enzyme-substrate binding; that is, in both complexes, Ser119 forms a high occupancy hydrogen bond with MDZ, which plays a key role in the stability of the interaction between MDZ and the enzymes. However, the complex formed by CYP 3A4 and MDZ is more stable, which may be attributed to the sandwich structure formed by the fluorophenyl group of the substrate with Leu216 and Leu482. Our study interprets the binding differences between two isoform-substrate complexes and reveals a structure-function relationship from the atomic perspective, which is expected to provide a theoretical basis for accurately measuring the effectiveness and toxicity of drugs for individuals in the era of precision medicine.

Active Binding Modes of Caffeine with Cytochrome P450 1A2 Determine Its Metabolite Profiles.

Caffeine is a very common kind of nervous stimulant, and it is primarily metabolized by Cytochrome P450 1A2 (CYP1A2) in the human body. Over the years, determining the interactions between caffeine and CYP1A2 has been a tough issue. The active binding modes and the catalytic regioselectivity of the metabolism between CYP1A2 and caffeine remain unclear. Here, to investigate the interactions between CYP1A2 and caffeine, we constructed the all-sequence CYP1A2-caffeine-membrane system using a multiple template approach. According to our simulation results, four active binding modes between CYP1A2 and caffeine that correspond to the four metabolic sites of caffeine are determined. What is more, a pre-reaction state for the CYP1A2-catalyzed reaction at caffeine's N3 site is identified. A more preponderant active binding mode might be the reason why the N3 site of caffeine becomes the primary metabolic site. Our findings could enhance our knowledge of the interactions between CYP1A2 and caffeine and help us better understand the regioselectivity of the metabolism between CYP1A2 and caffeine.

d-lactate modulates M2 tumor-associated macrophages and remodels immunosuppressive tumor microenvironment for hepatocellular carcinoma.

The polarization of tumor-associated macrophages (TAMs) from M2 to M1 phenotype demonstrates great potential for remodeling the immunosuppressive tumor microenvironment (TME) of hepatocellular carcinoma (HCC). d-lactate (DL; a gut microbiome metabolite) acts as an endogenous immunomodulatory agent that enhances Kupffer cells for clearance of pathogens. In this study, the potential of DL for transformation of M2 TAMs to M1 was confirmed, and the mechanisms underlying such polarization were mainly due to the modulation of phosphatidylinositol 3-kinase/protein kinase B pathway. A poly(lactide-co-glycolide) nanoparticle (NP) was used to load DL, and the DL-loaded NP was modified with HCC membrane and M2 macrophage-binding peptide (M2pep), forming a nanoformulation (DL@NP-M-M2pep). DL@NP-M-M2pep transformed M2 TAMs to M1 and remodeled the immunosuppressive TME in HCC mice, promoting the efficacy of anti-CD47 antibody for long-term animal survival. These findings reveal a potential TAM modulatory function of DL and provide a combinatorial strategy for HCC immunotherapy.

Dissecting the Effect of Temperature on Hyperthermophilic Pf2001 Esterase Dimerization by Molecular Dynamics.

Pf2001 esterase (Pf2001) from Pyrococcus furiosus has hyperthermophilic properties and exerts a biocatalytic function in a dimeric state. Crystal structures revealed that the structural rearrangement of the cap domain is responsible for the Pf2001 dimer formation. However, the details of the cap domain remodeling and the effects of temperature on the dimerization process remain elusive at the molecular level, taking into account that experimental methods are difficult to capture the dynamic process of dimerization to some extent. Herein, four dimer models based on the monomeric crystal structure (PDB ID: 5G59) were constructed to investigate the conformational transition details and temperature effects in the dimerization by conventional molecular dynamics and accelerated molecular dynamics simulations. Our simulation results indicate that the monomer undergoes a conformational change into a "preparatory state" at high temperatures, which is more favorable for its transformation into a stable dimer. The subsequent free energy landscape analysis further identifies four intermediate states (from separated state to dimeric state) and discloses that a more accessible α-helix driven by stronger hydrophobic interactions induces a rearrangement of the cap domain, displaying a "tic-tac-toe" activation feature that is important for stabilizing the dimer interface and facilitating the formation of hydrophobic pockets. In addition, the electrostatic potential surface analysis illustrates that the weaker electrostatic repulsion (Lys and Arg) in the dimer interface at high temperatures is also a key factor for dimer stabilization. Altogether, our results can provide molecular-level insight into the dimer formation process of hyperthermophilic esterase and would be useful to understand the enzymatic specificity of α/ß-hydrolase.

The Important Role of Transporter Structures in Drug Disposition, Efficacy, and Toxicity.

The ATP-binding cassette (ABC) and solute carrier (SLC) transporters are critical determinants of drug disposition, clinical efficacy, and toxicity as they specifically mediate the influx and efflux of various substrates and drugs. ABC transporters can modulate the pharmacokinetics of many drugs via mediating the translocation of drugs across biologic membranes. SLC transporters are important drug targets involved in the uptake of a broad range of compounds across the membrane. However, high-resolution experimental structures have been reported for a very limited number of transporters, which limits the study of their physiologic functions. In this review, we collected structural information on ABC and SLC transporters and described the application of computational methods in structure prediction. Taking P-glycoprotein (ABCB1) and serotonin transporter (SLC6A4) as examples, we assessed the pivotal role of structure in transport mechanisms, details of ligand-receptor interactions, drug selectivity, the molecular mechanisms of drug-drug interactions, and differences caused by genetic polymorphisms. The data collected contributes toward safer and more effective pharmacological treatments. SIGNIFICANCE STATEMENT: The experimental structure of ATP-binding cassette and solute carrier transporters was collected, and the application of computational methods in structure prediction was described. P-glycoprotein and serotonin transporter were used as examples to reveal the pivotal role of structure in transport mechanisms, drug selectivity, the molecular mechanisms of drug-drug interactions, and differences caused by genetic polymorphisms.

Insights into the binding mechanism between α-TOH and CYP4F2: A homology modeling, molecular docking, and molecular dynamics simulation study.

α-Tocopherol (α-TOH) is a potent antioxidant. The concentrations of α-TOH in plasma are closely related to human health. α-TOH can be regulated by the metabolism of cytochrome P450 4F2 (CYP4F2). However, the atomic-level basis for this regulation process remains elusive. Here, we successfully constructed the structure of CYP4F2 by homology modeling and obtained the α-TOH-CYP4F2 complex models using molecular docking. Three parallel 500 ns molecular dynamics simulations were performed on each complex model to investigate the details of the interaction between α-TOH and CYP4F2. MM-GBSA method combined with principal component analysis shows that 8 key residues establish a hydrophobic cavity stabilizing α-TOH in the pocket of CYP4F2 and S423 forms an important hydrogen bond with α-TOH anchoring α-TOH in the favorable position for ω-hydroxylation. Based on our simulation results and the experimental facts, we designed mutation simulation experiments to clarify the important role of two key residues (S423 and V433) in the binding of α-TOH with CYP4F2. The results show that the mutations directly or indirectly change the binding mode of α-TOH and decrease its binding affinity with CYP4F2, which is unfavorable for ω-hydroxylation. Our results could enrich the information on structure-function relationships of CYP4F2 and provide valuable insights into the regulatory mechanism of CYP4F2 on the metabolism of α-TOH.

How does multiple substrate binding lead to substrate inhibition of CYP2D6 metabolizing dextromethorphan? A theoretical study.

CYP2D6 is one of the most important metalloenzymes involved in the biodegradation of many drug molecules in the human body. It has been found that multiple substrate binding can lead to substrate inhibition of CYP2D6 metabolizing dextromethorphan (DM), but the corresponding theoretical mechanism is rarely reported. Therefore, we chose DM as the probe and performed molecular dynamics simulations and quantum mechanical calculations on CYP2D6-DM systems to investigate the mechanism of how the multiple substrate binding leads to the substrate inhibition of CYP2D6 metabolizing substrates. According to our results, three gate residues (Arg221, Val374, and Phe483) for the catalytic pocket are determined. We also found that the multiple substrate binding can lead to substrate inhibition by reducing the stability of CYP2D6 binding DM and increasing the reactive activation energy of the rate-determining step. Our findings would help to understand the substrate inhibition of CYP2D6 metabolizing the DM and enrich the knowledge of the drug-drug interactions for the cytochrome P450 superfamily.

A direct approach toward investigating DNA-ligand interactions via surface-enhanced Raman spectroscopy combined with molecular dynamics simulations.

Small molecules that interfere with DNA replication can trigger genomic instability, which makes these molecules valuable in the search for anticancer drugs. Thus, interactions between DNA and its ligands at the molecular level are of great significance. In the present study, a new method based on surface-enhanced Raman spectroscopy (SERS) combined with molecular dynamics simulations has been proposed for analyzing the interactions between DNA and its ligands. The SERS signals of DNA hairpins (ST: d(CGACCAACGTGTCGCCTGGTCG), AP1: d(CGCACAACGTGTCGCCTGTGCG)), pure argininamide, and their complexes, were obtained, and the characteristic peak sites of the DNA secondary structure and argininamide ligand-binding region were analyzed. Molecular dynamics calculations predicted that argininamide binds to the 8C and 9G bases of AP1 via hydrogen bonding. Our method successfully detected the changes of SERS fingerprint peaks of hydrogen bonds and bases between argininamide and DNA hairpin bases, and their binding sites and action modes were consistent with the predicted results of the molecular dynamics simulations. This SERS technology combined with the molecular dynamics simulation detection platform provides a general analysis tool, with the advantage of effective, rapid, and sensitive detection. This platform can obtain sufficient molecular level conformational information to provide avenues for rapid drug screening and promote progress in several fields, including targeted drug design.

Molecular Insights into the Heterotropic Allosteric Mechanism in Cytochrome P450 3A4-Mediated Midazolam Metabolism.

Cytochrome P450 3A4 (CYP3A4) is the main P450 enzyme for drug metabolism and drug-drug interactions (DDIs), as it is involved in the metabolic process of approximately 50% of drugs. A detailed mechanistic elucidation of DDIs mediated by CYP3A4 is commonly believed to be critical for drug optimization and rational use. Here, two typical probes, midazolam (MDZ, substrate) and testosterone (TST, allosteric effector), are used to investigate the molecular mechanism of CYP3A4-mediated heterotropic allosteric interactions, through conventional molecular dynamics (cMD) and well-tempered metadynamics (WT-MTD) simulations. Distance monitoring shows that TST can stably bind in two potential peripheral sites (Site 1 and Site 2) of CYP3A4. The binding of TST at these two sites can induce conformational changes in CYP3A4 flexible loops on the basis of conformational analysis, thereby promoting the transition of the MDZ binding mode and affecting the ratio of MDZ metabolites. According to the results of the residue interaction network, multiple allosteric communication pathways are identified that can provide vivid and applicable insights into the heterotropic allostery of TST on MDZ metabolism. Comparing the regulatory effects and the communication pathways, the allosteric effect caused by TST binding in Site 2 seems to be more pronounced than in Site 1. Our findings could provide a deeper understanding of CYP3A4-mediated heterotropic allostery at the atomic level and would be helpful for rational drug use as well as the design of new allosteric modulators.

Molecular Basis of the Recognition of Cholesterol by Cytochrome P450 46A1 along the Major Access Tunnel.

CYP46A1 is an important potential target for the treatment of Alzheimer's disease (AD), which is the most common neurodegenerative disease among older individuals. However, the binding mechanism between CYP46A1 and substrate cholesterol (CH) has not been clarified and will not be conducive to the research of relevant drug molecules. In this study, we integrated molecular docking, molecular dynamics (MD) simulations, and adaptive steered MD simulations to explore the recognition and binding mechanism of CYP46A1 with CH. Two key factors affecting the interaction between CH and CYP46A1 are determined: one is a hydrophobic cavity formed by seven hydrophobic residues (F80, Y109, L112, I222, W368, F371, and T475), which provides nonpolar interactions to stabilize CH, and the other is a hydrogen bond formed by H81 and CH, which ensures the binding direction of CH. In addition, the tunnel analysis results show that tunnel 2a is identified as the primary pathway of CH. The entry of CH induces tunnel 2e to close and tunnel w to open. Our results may provide effective clues for the design of drugs based on the substrate for AD and improve our understanding of the structure-function of CYP46A1.

Multiple Molecular Dynamics Simulations and Energy Analysis Unravel the Dynamic Properties and Binding Mechanism of Mutants HIV-1 Protease with DRV and CA-p2.

PRS17, a variant of human immunodeficiency virus type I protease (HIV-1 PR), has 17 mutated residues showing high levels of multidrug resistance. To describe the effects of these mutated residues on the dynamic properties and the binding mechanism of PR with substrate and inhibitor, focused on six systems (two complexes of WT PR and PRS17 with inhibitor Darunavir (DRV), two complexes of WT PR and PRS17 with substrate analogue CA-p2, two unligand WT PR and PRS17), we performed multiple molecular dynamics (MD) simulations combined with MM-PBSA and solvated interaction energy (SIE) methods. For both the unligand PRs and ligand-PR complexes, the results from simulations revealed 17 mutated residues alter the flap-flap distance, the distance from flap regions to catalytic sites, and the curling degree of the flap tips. These mutated residues changed the flexibility of the flap region in PR, and thus affected its binding energy with DRV and CA-p2, resulting in differences in sensitivity. Hydrophobic cavity makes an important contribution to the binding of PR and ligands. And most noticeable of all, the binding of the guanidine group in CA-p2 and Arg8' of PRS17 is useful for increasing their binding ability. These results have important guidance for the further design of drugs against multidrug resistant PR. IMPORTANCE Developing effective anti-HIV inhibitors is the current requirement to cope with the emergence of the resistance of mutants. Compared with the experiments, MD simulations along with energy calculations help reduce the time and cost of designing new inhibitors. Based on our simulation results, we propose two factors that may help design effective inhibitors against HIV-1 PR: (i) importance of hydrophobic cavity, and (ii) introduction of polar groups similar to the guanidine group.

Investigation of the molecular and mechanistic basis for the regioselective metabolism of midazolam by cytochrome P450 3A4.

Cytochrome P450 3A4 (CYP3A4) is the most important P450 enzyme for drug metabolism and drug-drug interaction, due to it being responsible for the biotransformation of approximately 50% of clinically used drugs. Advance knowledge of the molecular and mechanistic basis of CYP3A4 regioselective metabolism is beneficial for understanding the production of metabolites, and may allow personalized metabolic pathways or designing pathway-specific therapeutics. In this work, we focus on investigating the ligand-receptor interactions, substrate conformational transition, and key factors regulating the specificity of metabolic pathways using midazolam (MDZ) as a probe. Here, three types of substrate-binding conformations related to the diversity of MDZ metabolites are identified. The results also suggest that an allosteric site for MDZ is located near the F'-helix, A-anchor, and C-terminal loop of CYP3A4. The presence of an effector in the allosteric site can accelerate the conformational transition of the substrate via modulating a "sandwich" structure, and may affect the proportion of metabolites at high substrate concentration. We hope that the results can improve the understanding of the CYP3A4 structure and function, and provide a new perspective for drug development.

Theoretical investigations on the effects of mutations in important residues of NS1B on its RNA-binding using molecular dynamics simulations.

NS1B protein plays an important role in countering host antiviral defense and virulence of influenza virus B, considered as the promising target. The first experimental structure of the NS1B protein has recently been determined, was able to bind to double-stranded RNA (dsRNA). However, few studies attempt to investigate the RNA-binding mechanism of the NS1B. In this study, we provide our understanding of the structure-function relationship, dynamics and RNA-binding mechanism of the NS1B protein by performing molecular dynamics simulations combined and MM-GBSA calculations on the NS1B-dsRNA complex. 12 key residues are identified for RNA-binding by forming hydrogen bonds with the. Our results also demonstrate that mutations (R156A, K160A, R208A and K221A) can cause the local structure changes of NS1B CTD and the hydrogen bonds between NS1B CTD and RNA disappearance, which may be the main reasons for the decrease in RNA-binding affinity. These results mentioned will help us understanding the RNA-binding mechanism and could provide some medicinal chemistry insights chances for rational drug design targeting NS1B protein.

The regioselectivity of the interaction between dextromethorphan and CYP2D6.

CYP2D6 is an important enzyme of the cytochrome P450 superfamily, and catalyzes nearly 25% of the drugs sold in the market. For decades, the interactions and metabolism between CYP2D6 and substrates have been a hot topic. However, the key factors of the catalytic regioselectivity for CYP2D6 still remain controversial. Here, we construct four systems to explore the interaction between dextromethorphan (DM) and CYP2D6. A new binding mode of CYP2D6 is defined, and two key residues (residue Asp301 and residue Glu216) are discovered working simultaneously to stabilize the DM at the reactive site by forming water bridge hydrogen bonds when CYP2D6 binds DM. Our results also indicate that the substrate concentration could mediate the binding mode between the substrate and CYP2D6 by decreasing the volume of the catalytic pocket, which is not conducive to the O-demethylation of DM but benefits the N-demethylation of DM. These results could shed light on the process of CYP2D6 binding to the substrate, and help to better understand the regioselectivity of CYP2D6 catalyzing the substrates.

VARIDT 2.0: structural variability of drug transporter.

The structural variability data of drug transporter (DT) are key for research on precision medicine and rational drug use. However, these valuable data are not sufficiently covered by the available databases. In this study, a major update of VARIDT (a database previously constructed to provide DTs' variability data) was thus described. First, the experimentally resolved structures of all DTs reported in the original VARIDT were discovered from PubMed and Protein Data Bank. Second, the structural variability data of each DT were collected by literature review, which included: (a) mutation-induced spatial variations in folded state, (b) difference among DT structures of human and model organisms, (c) outward/inward-facing DT conformations and (d) xenobiotics-driven alterations in the 3D complexes. Third, for those DTs without experimentally resolved structural variabilities, homology modeling was further applied as well-established protocol to enrich such valuable data. As a result, 145 mutation-induced spatial variations of 42 DTs, 1622 inter-species structures originating from 292 DTs, 118 outward/inward-facing conformations belonging to 59 DTs, and 822 xenobiotics-regulated structures in complex with 57 DTs were updated to VARIDT (https://idrblab.org/varidt/ and http://varidt.idrblab.net/). All in all, the newly collected structural variabilities will be indispensable for explaining drug sensitivity/selectivity, bridging preclinical research with clinical trial, revealing the mechanism underlying drug-drug interaction, and so on.

A novel benzotriazole derivate with Twisted intramolecular charge transfer and Aggregation Induced emission features for proton determination.

Molecules with Aggregation-Induced Emission (AIE) effects could show strong emission in solid or aggregate form, thus they are suitable for applications in the field of solid luminescent materials. According to former reporting, AIE molecules are always J-aggregates. In this study, a new benzotriazole derivate with electron donor-acceptor structure was synthesized. (E)-4-(2-(1H-benzo[d] [1,2,3] triazol-1-yl) vinyl)-N, N-dimethylaniline (BTADA) has both TICT and AIE effect, even though it is H-aggregate. Furthermore, BTADA could respond to proton in solution and solid form. Due to its multiple binging sites, proton would bind to benzotriazole and dimethylaniline moiety successively when BTADA was exposed to acid, and the fluorescent color changed from green to yellow then blue as the concentration of proton increased. Such phenomena indicate BTADA has potential usage in proton detection.